Man page - gt-fingerprint(1)

Packages contas this manual

Manual

GT-FINGERPRINT(1) GenomeTools Manual GT-FINGERPRINT(1)

gt-fingerprint - Compute MD5 fingerprints for each sequence given in a set of sequence files.

gt fingerprint [option ...] sequence_file [...]

-check [filename]

compare all fingerprints contained in the given checklist file with checksums in given sequence_files(s). The comparison is successful, if all fingerprints given in checkfile can be found in the sequence_file(s) in the exact same quantity and vice versa. (default: undefined)

-duplicates [yes|no]

show duplicate fingerprints from given sequence_file(s). (default: no)

-extract [string]

extract the sequence(s) with the given fingerprint from sequence file(s) and show them on stdout. (default: undefined)

-width [value]

set output width for FASTA sequence printing (0 disables formatting) (default: 0)

-o [filename]

redirect output to specified file (default: undefined)

-gzip [yes|no]

write gzip compressed output file (default: no)

-bzip2 [yes|no]

write bzip2 compressed output file (default: no)

-force [yes|no]

force writing to output file (default: no)

-help

display help and exit

-version

display version information and exit

If neither option -check nor option -duplicates is used, the fingerprints for all sequences are shown on stdout.

Fingerprint of a sequence is case insensitive. Thus MD5 fingerprint of two identical sequences will be the same even if one is soft-masked.

Compute (unified) list of fingerprints:

$ gt fingerprint U89959_ests.fas | sort | uniq > U89959_ests.checklist_uniq

Compare fingerprints:

$ gt fingerprint -check U89959_ests.checklist_uniq U89959_ests.fas
950b7715ab6cc030a8c810a0dba2dd33 only in sequence_file(s)

Make sure a sequence file contains no duplicates (not the case here):

$ gt fingerprint -duplicates U89959_ests.fas
950b7715ab6cc030a8c810a0dba2dd33        2
gt fingerprint: error: duplicates found: 1 out of 200 (0.500%)

Extract sequence with given fingerprint:

$ gt fingerprint -extract 6d3b4b9db4531cda588528f2c69c0a57 U89959_ests.fas
>SQ;8720010
TTTTTTTTTTTTTTTTTCCTGACAAAACCCCAAGACTCAATTTAATCAATCCTCAAATTTACATGATAC
CAACGTAATGGGAGCTTAAAAATA

•0 everything went fine (-check: the comparison was successful; -duplicates: no duplicates found)

•1 an error occurred (-check: the comparison was not successful; -duplicates: duplicates found)

Report bugs to https://github.com/genometools/genometools/issues.

04/27/2024 GenomeTools 1.6.5