Man page - gt-fingerprint(1)
Packages contas this manual
- gt-scriptfilter(1)
- gt-mmapandread(1)
- gt-gff3(1)
- gt-ltrdigest(1)
- gt-encseq(1)
- gt-extractfeat(1)
- gt-seed_extend(1)
- gt-dupfeat(1)
- gt-csa(1)
- gt-clean(1)
- gt-packedindex(1)
- gt-genomediff(1)
- gt-sketch_page(1)
- gt-compreads-refcompress(1)
- gt-splicesiteinfo(1)
- gt-extractseq(1)
- gt-compreads(1)
- gt-encseq-decode(1)
- gt-cds(1)
- gt-encseq-bitextract(1)
- gt-readjoiner(1)
- gt-tallymer-occratio(1)
- gt-tallymer(1)
- gt-sequniq(1)
- gt-id_to_md5(1)
- gt-readjoiner-prefilter(1)
- gt-seqtranslate(1)
- gt-tallymer-search(1)
- gt-condenseq(1)
- gt-seqmutate(1)
- gt-seqorder(1)
- gt-seq(1)
- gt-inlineseq_add(1)
- gt-repfind(1)
- gt-seqfilter(1)
- gt-sketch(1)
- gt-hop(1)
- gt-seqids(1)
- gt-fastq_sample(1)
- gt-compreads-refdecompress(1)
- gt-readjoiner-assembly(1)
- gt-readjoiner-overlap(1)
- gt-splitfasta(1)
- gt-seqtransform(1)
- gt-tallymer-mkindex(1)
- gt-wtree(1)
- gt-ltrharvest(1)
- gt-chseqids(1)
- gt-compreads-decompress(1)
- gt-orffinder(1)
- gt-encseq-sample(1)
- gt-encseq-md5(1)
- gt-merge(1)
- gt-gff3validator(1)
- gt-matchtool(1)
- gt-congruence(1)
- gt-tagerator(1)
- gt-gff3_to_gtf(1)
- gt-featureindex(1)
- gt-md5_to_id(1)
- gt-mkfeatureindex(1)
- gt-tirvish(1)
- gt-snpper(1)
- gt-prebwt(1)
- gt-stat(1)
- gt-speck(1)
- gt-convertseq(1)
- gt-compreads-compress(1)
- gt-interfeat(1)
- gt-chain2dim(1)
- gt-encseq-bench(1)
- gt-shulengthdist(1)
- gt-encseq-encode(1)
- gt-select(1)
- gt-uniq(1)
- gt-shredder(1)
- gt-fingerprint(1)
- gt-matstat(1)
- gt-encseq-info(1)
- gt-congruence-spacedseed(1)
- gt-encseq2spm(1)
- gt-simreads(1)
- gt(1)
- gt-dot(1)
- gt-ltrclustering(1)
- gt-seqstat(1)
- gt-mergefeat(1)
- gt-bed_to_gff3(1)
- gt-uniquesub(1)
- gt-gtf_to_gff3(1)
- gt-eval(1)
- gt-encseq-check(1)
- gt-loccheck(1)
- gt-inlineseq_split(1)
Package: genometools
apt-get install genometools
apt-get install genometools
Manuals in package:
Documentations in package:
Manual
| GT-FINGERPRINT(1) | GenomeTools Manual | GT-FINGERPRINT(1) |
NAME
gt-fingerprint - Compute MD5 fingerprints for each sequence given in a set of sequence files.
SYNOPSIS
gt fingerprint [option ...] sequence_file [...]
DESCRIPTION
-check [filename]
compare all fingerprints contained in the given checklist
file with checksums in given sequence_files(s). The comparison is successful,
if all fingerprints given in checkfile can be found in the sequence_file(s) in
the exact same quantity and vice versa. (default: undefined)
-duplicates [yes|no]
show duplicate fingerprints from given sequence_file(s).
(default: no)
-extract [string]
extract the sequence(s) with the given fingerprint from
sequence file(s) and show them on stdout. (default: undefined)
-width [value]
set output width for FASTA sequence printing (0 disables
formatting) (default: 0)
-o [filename]
redirect output to specified file (default:
undefined)
-gzip [yes|no]
write gzip compressed output file (default: no)
-bzip2 [yes|no]
write bzip2 compressed output file (default: no)
-force [yes|no]
force writing to output file (default: no)
-help
display help and exit
-version
display version information and exit
If neither option -check nor option -duplicates is used, the fingerprints for all sequences are shown on stdout.
Fingerprint of a sequence is case insensitive. Thus MD5 fingerprint of two identical sequences will be the same even if one is soft-masked.
EXAMPLES
Compute (unified) list of fingerprints:
$ gt fingerprint U89959_ests.fas | sort | uniq > U89959_ests.checklist_uniq
Compare fingerprints:
$ gt fingerprint -check U89959_ests.checklist_uniq U89959_ests.fas 950b7715ab6cc030a8c810a0dba2dd33 only in sequence_file(s)
Make sure a sequence file contains no duplicates (not the case here):
$ gt fingerprint -duplicates U89959_ests.fas 950b7715ab6cc030a8c810a0dba2dd33 2 gt fingerprint: error: duplicates found: 1 out of 200 (0.500%)
Extract sequence with given fingerprint:
$ gt fingerprint -extract 6d3b4b9db4531cda588528f2c69c0a57 U89959_ests.fas >SQ;8720010 TTTTTTTTTTTTTTTTTCCTGACAAAACCCCAAGACTCAATTTAATCAATCCTCAAATTTACATGATAC CAACGTAATGGGAGCTTAAAAATA
RETURN VALUES
•0 everything went fine (-check: the
comparison was successful; -duplicates: no duplicates found)
•1 an error occurred (-check: the
comparison was not successful; -duplicates: duplicates found)
REPORTING BUGS
Report bugs to https://github.com/genometools/genometools/issues.
| 04/27/2024 | GenomeTools 1.6.5 |