Man page - trf(1)

Packages contas this manual

    Package:  trf
    apt-get install trf
    Manuals in package:
    Documentations in package:

Manual

TRF(1) User Commands TRF(1)

trf - locate and display tandem repeats in DNA sequences

trf (File|Match|Mismatch|Delta|PM|PI|Minscore|MaxPeriod) [options]

Where: (all weights, penalties, and scores are positive)

sequences input file
matching weight
mismatching penalty
indel penalty
match probability (whole number)
indel probability (whole number)
minimum alignment score to report
maximum period size to report

masked sequence file
flanking sequence
data file
suppress html output
no redundancy elimination
maximum TR length expected (in millions) (eg, -l 3 or -l=3 for 3 million) Human genome HG38 would need -l 6
more compact .dat output on multisequence files, returns 0 on success. Output is printed to the screen, not a file. You may pipe input in with this option using - for file name. Short 50 flanks are appended to .dat output.

See more information on the TRF Unix Help web page: https://tandem.bu.edu/trf/trf.unix.help.html

Note the sequence file should be in FASTA format:

>Name of sequence aggaaacctgccatggcctcctggtgagctgtcctcatccactgctcgctgcctctccag atactctgacccatggatcccctgggtgcagccaagccacaatggccatggcgccgctgt actcccacccgccccaccctcctgatcctgctatggacatggcctttccacatccctgtg

Copyright © 1999-2020 Gary Benson

This manpage was written by Andreas Tille for the Debian distribution and can be used for any other usage of the program.

June 2020 trf 4.09.1