Man page - trf(1)
Packages contas this manual
Manual
| TRF(1) | User Commands | TRF(1) |
NAME
trf - locate and display tandem repeats in DNA sequences
SYNOPSIS
trf (File|Match|Mismatch|Delta|PM|PI|Minscore|MaxPeriod) [options]
OPTIONS
Where: (all weights, penalties, and scores are positive)
- File
- sequences input file
- Match
- matching weight
- Mismatch
- mismatching penalty
- Delta
- indel penalty
- PM
- match probability (whole number)
- PI
- indel probability (whole number)
- Minscore
- minimum alignment score to report
- MaxPeriod
- maximum period size to report
[options] = one or more of the following:
- -m
- masked sequence file
- -f
- flanking sequence
- -d
- data file
- -h
- suppress html output
- -r
- no redundancy elimination
- -l <n>
- maximum TR length expected (in millions) (eg, -l 3 or -l=3 for 3 million) Human genome HG38 would need -l 6
- -ngs
- more compact .dat output on multisequence files, returns 0 on success. Output is printed to the screen, not a file. You may pipe input in with this option using - for file name. Short 50 flanks are appended to .dat output.
SEE ALSO
See more information on the TRF Unix Help web page: https://tandem.bu.edu/trf/trf.unix.help.html
NOTE
Note the sequence file should be in FASTA format:
>Name of sequence aggaaacctgccatggcctcctggtgagctgtcctcatccactgctcgctgcctctccag atactctgacccatggatcccctgggtgcagccaagccacaatggccatggcgccgctgt actcccacccgccccaccctcctgatcctgctatggacatggcctttccacatccctgtg
AUTHOR
Copyright © 1999-2020 Gary Benson
This manpage was written by Andreas Tille for the Debian distribution and can be used for any other usage of the program.
| June 2020 | trf 4.09.1 |